• We’re currently investigating an issue related to the forum theme and styling that is impacting page layout and visual formatting. The problem has been identified, and we are actively working on a resolution. There is no impact to user data or functionality, this is strictly a front-end display issue. We’ll post an update once the fix has been deployed. Thanks for your patience while we get this sorted.

anyone else taking the Biology SAT II today?

I'm taking it next year, after a wonderful year of AP Bio 😉

GL Tim! 🙂

(Hopefully everything Lyons tought you...err didn't teach you... will help 🙂)
 
Originally posted by: deftron
Whats the amino acid sequence of the protein with this DNA code?

CCCTGTGGAGCCACACCCTGTTAG
Click to expand...


um they better not have asked you that w/o showing you the AA chart
 
Heard my little sister took it... after her frosh year Biology class... I never really bothered with the SAT II exams related to the sciences... but for all you youngsters out there, even if you don't think you'll do well, take as many as possible so you dont' have to crunch it all in your senior year.
 
Actually just finished it; wasn¡¦t as difficult as I had thought it was going to be (which was high considering I hadn¡¦t taken AP Bio, and just read the Sparknote book). Also took the Math IC, which trickily got you all over excited with a bunch of really easy questions then slammed you with harder ones. I¡¦m not really that concerned about either of my scores seeing as I am not going to send either of them to colleges (as far as SAT II goes, I¡¦m going to send in Math IIC, the writing one, and chemistry after I finish my AP class next year). Good Luck 🙂

-CybDude

PS: Didn?t ask me anything about amino acids matching DNA sequences, might want to know how to code it for mRNA though (GGGACACCUCGGUGUGGGACAAUC)
 
You must log in or register to reply here.

TRENDING THREADS

Back
Top